MendelicsLogo Design Contest Logo Design Contest Contests / Mendelics Mendelics has selected their winning logo design. For $275 they received 106 designs from 12 different designers from around the world. Find out how LogoTournament works How LogoTournament works Contest Entries by nicefreelancer Return to Contest Return to Contest 1st #74 Withdrawn 5th #87 Withdrawn 6th #106 Withdrawn New #32 Withdrawn New #100 Withdrawn New #38 Withdrawn Prefers others. #99 Withdrawn Prefers others. #92 Withdrawn Prefers others. #91 Withdrawn Prefers others. #90 Withdrawn Prefers others. #89 Withdrawn Prefers others. #88 Withdrawn Prefers others. #86 Withdrawn Prefers others. #85 Withdrawn Prefers others. #82 Withdrawn Prefers others. #81 Withdrawn Prefers others. #79 Withdrawn Prefers others. #78 Withdrawn Prefers others. #77 Withdrawn Prefers others. #76 Withdrawn Prefers others. #75 Withdrawn Prefers others. #73 Withdrawn Prefers others. #70 Withdrawn Prefers others. #69 Withdrawn Prefers others. #41 Withdrawn Prefers others. #40 Withdrawn Prefers others. #39 Withdrawn Prefers others. #37 Withdrawn Prefers others. #36 Withdrawn Prefers others. #31 Withdrawn Prefers others. #30 Discussion mendelics Client Preferimos não ter uma cruz como símbolo. 12 years ago mendelics Client Gostei, mas estou procurando algo um pouco mais simples. Essa é uma ótima idéia, mas não gostei do formato do "M". Além disso, acho que ficaria bom em 2 dimensões (sem perspectiva). 12 years ago nicefreelancer Logo Designer ok! fiz mais 2 versoes de uma olhada...surgindo idéias ja vou colocando :) 12 years ago mendelics Client Achei que o M maiúsculo ficou ótimo. Mas gostaria que não houvesse letras cortadas dentro do M. 12 years ago nicefreelancer Logo Designer Legal!Ok a borda do M vai ficar um pouco irregular, mas a gente testa. 12 years ago mendelics Client Este está excelente. Será que um "M" Sans Serif não fica melhor? 12 years ago nicefreelancer Logo Designer Postei 2 sans serif, e estou colocando mais ideias.. 12 years ago mendelics Client #78 ficou muito interessante. Talvez o espaço em branco um pouco mais grosso fique melhor.#74 ficou exepcional. Você pode fazer variantes dele em 1 cor única (variantes de roxo, amarelo, laranja) e/ou testar o código em negrito também? 12 years ago mendelics Client #81 Você pode retirar aquela linha clara/sinuosa do fundo? Acho que atrapalha. 12 years ago mendelics Client Não precisa fazer isso agora, mas seria legal usar o começo desta sequencia de DNA:ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG 12 years ago nicefreelancer Logo Designer Oi!Fiz as alterações. A ideia da linha ao fundo é formar um quebra-cabeça, fiz ele melhor nessa versao #85 12 years ago nicefreelancer Logo Designer O #92 está com a sequência que voce pediu. 12 years ago nicefreelancer Logo Designer Obrigado pela vitória! Nao posso mandar o eps hoje pois não estou em meu computador, segunda de manhã envio ok? Abraço! 12 years ago nicefreelancer Logo Designer Bom dia,Já coloquei os arquivos finais, pode conferir quando puder. Obrigado ! 12 years ago